Journal: Cell reports

Article Title: Ku proteins promote DNA binding and condensation of cyclic GMP-AMP synthase.

doi: 10.1016/j.celrep.2022.111310

Figure Lengend Snippet: Figure 4. Ku proteins augment cGAS cata- lytic activity by promoting cGAS-DNA binding (A and B) Ku80- (A) or Ku70- (B) knockdown and control THP-1 cells were stimulated with HT-DNA (1 mg/mL) for 6 h. The cells were harvested for cGAMP measurement by ELISA (top) and immu- noblotting assay (bottom). (C) Recombinant cGAS (0.5 mM) and GFP (4 mM), Ku80 (0.9 mM), or Ku70 (0.9 or 4 mM) were incubated with HT-DNA (0.2 mg/mL). cGAMP production was measured by ELISA. (D) Ku80- or Ku70-knockdown and control THP-1 cells were transfected with biotin-ISD (1 mg/mL) for 2 h. The cell lysates were incubated with streptavi- din-Sepharose beads for 4 h and analyzed by immunoprecipitation and immunoblotting. (E) Similar to (D), except wild-type and Ku80-defi- cient HeLa cells were used. (F) Recombinant cGAS protein (3.4 nM) together with GFP (100 nM), Ku80 (5 nM), or Ku70 (5 or 100 nM) was incubated with streptavidin-Sephar- ose beads with or without biotin-ISD (1 mg) for 3 h and then pulled down with streptavidin-Sepharose beads and analyzed by immunoblotting. (G) Recombinant GFP (5.5 nM) or Ku80 (2.75 or 5.5 nM) was incubated with or without cGAS (100 nM) in the presence of Cy5-ISD (1.25 mM) and analyzed by EMSA to measure cGAS-DNA binding ability. Data shown in (A–C) are from one representative experiment of at least three independent experi- ments (mean ± SD, n = 2 biological replicates). *p < 0.05, **p < 0.01, two-tailed Student’s t test. See also Figure S6.

Article Snippet: HEK293T ATCC CRL-11268 HEK293A Hongyu Deng, Institute of Biophysics, Chinese Academy of Sciences N/A HeLa ATCC CCL-2 Vero ATCC CCL-81 immortalized MEF This paper N/A HEK293T stably expressing Flag-STING This paper N/A Ku80 deficiency THP-1 This paper N/A Ku70 deficiency THP-1 This paper N/A DNA-PKcs knockout THP-1 This paper N/A DNA-PKcs knockout HEK293T This paper N/A cGAS knockout THP-1 This paper N/A STING knockout THP-1 This paper N/A Oligonucleotides ISD:sense 50-TACAGATCTACTAGTG ATCTATGACTGATCTGTACATGATCTACA-30 This paper N/A sgRNA and shRNA, see Table S2 This paper N/A primers for qPCR, see Table S3 This paper N/A Recombinant DNA IFNb-Luc Hongbing Shu, Wuhan University N/A ISRE-Luc Hongbing Shu, Wuhan University N/A NF-kB-Luc Zhijian Chen, University of Texas, Southwestern Medical Center at Dallas N/A Other recombinant DNA used in this study are listed in Table S1 This paper N/A Software and algorithms GraphPad Prism 8 GraphPad https://www.graphpad.com/guides/prism/ 8/user-guide/tips_for_using_prism.htm ImageJ NIH https://imagej.nih.gov/ij/download.html NIS-Elements AR Analysis 5.20.00 NIKON https://www.microscope.healthcare. nikon.com/products/software/ nis-elements Imaris 9.5.1 IMARIS https://imaris.oxinst.com/ Cell Reports 40, 111310, September 6, 2022 e2

Techniques: Activity Assay, Binding Assay, Knockdown, Control, Enzyme-linked Immunosorbent Assay, Recombinant, Incubation, Transfection, Immunoprecipitation, Western Blot, Two Tailed Test

Journal: Cell reports

Article Title: Identification of CCL3 as a Schwann cell chemotactic factor essential for nerve regeneration.

doi: 10.1016/j.celrep.2025.115322

Figure Lengend Snippet: Figure 2. CCL3 is a chemoattractant for Schwann cells (A) Rat SC migration in Boyden chambers in response to no factors (control), 3% serum (serum), or 10 or 50 ng/ml CCL3 diluted in 0.1% bovine serum albumin/ PBS (n = 8 independent experiments).

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines THP-1 cell line Prof. Mark Marsh laboratory N/A J774A.1 mouse macrophage cell line Sigma-Aldrich Cat: 91051511 Experimental models: Organisms/strains B6; CBA-Tg(Plp1-EGFP)10Wmac/J mice (Mallon et al.35) Cattin et al.14 Cattin et al.14 Strain# 033357; RRID:IMSR_JAX:033357 B6.129P2-Ccl3tm1Unc/J (CCL3 KO) mice The Jackson Laboratory Strain #:002687; RRID:IMSR_JAX:002687 PLP-eGFP-CCL3 KO mice This paper N/A Sprague-Dawley rats Charles River Laboratories 001 Cat#734476; RRID:RGD734476 Oligonucleotides Rat CCL3: Fwd: 50- CCATATGGAGCTGACACCCC-30 Rev: 50- TCTGCCGGTTTCTCTTGGTC-30 This Paper N/A Mouse CCL3: Fwd: 50- CCATATGGAGCTGACACCCC-30 Rev: 50- AAATGACACCTGGCTGGGAG-30 This Paper N/A Human CCL3: Fwd: 50- ACATTCCGTCACCTGCTCAG -30 Rev: 50- TTGTTGCCAAACAGCCACAC-30 This Paper N/A Rat CCR1: Fwd: 50- CAAAGGCCCAGAAACAAAGCC-30 Rev: 50- AGCCCCGAAGGCTCTTACAT-30 This Paper N/A Human CCR1: Fwd: 50- GGTCCTGGTCCTTGTGCAAT-30 Rev: 50- AGGGAAGCGTGAACAGGAAG-30 This Paper N/A CCL3 siRNA 1: 50-CTAGGTAGACATGATGACAAA-30 This Paper N/A CCL3 siRNA 3: 50-TCGAGGGACTCTTCACTTGAA-30 This Paper N/A CCR1 siRNA: 50-CAGACCCTAGGTGTCAACCAA-30 This Paper N/A Scr: 50-AATTCTCCGAACGTGTCACGT-30 This Paper N/A HCRTM CCL3-B3 probes set Molecular instruments HCRTM HCRTM CCR2-B2 probes set Molecular instruments HCRTM Software and algorithms Fiji/ImageJ Schindelin et al.54 https://imagej.net/Fiji/Downloads Prism GraphPad https://www.graphpad.com/ scientificsoftware/prism Adobe Photoshop CC Adobe Systems https://www.adobe.com Adobe Illustrator CC Adobe Systems https://www.adobe.com Volocity Improvision https://www.volocity4d.com/ Other SPE3 Leica TCS SPE 405nm, 488nm, 561nm and 635nm SPE8 Leica TCS SPE8 STED 3x 405nm, 488nm, 561nm and 635nm LSM900 Zeiss LSM900 405, 488, 561 and 640 lasers Transmission electron microscope (TEM) FEI Tecnai 12 Spirit BioTwin OSIS morada Axiovert 200M Zeiss Axiovert 200M Phase contrast (Transmitted light microscopy) Axio Imager.A1 Zeiss Axio Imager.A1 405nm Subio X Omics Subio Platform https://www.subioplatform.com/ Other RNA-Seq raw and analyzed data Clements et al.28 GEO: GSE103039 Cell Reports 44, 115322, February 25, 2025 17

Techniques: Migration, Control

Journal: Cell reports

Article Title: Identification of CCL3 as a Schwann cell chemotactic factor essential for nerve regeneration.

doi: 10.1016/j.celrep.2025.115322

Figure Lengend Snippet: Figure 4. CCL3 ablation impairs Schwann cell migration and axonal regrowth following injury (A and B) Representative confocal images of immunostained longitudinal sections of control and CCL3 KO mouse sciatic nerves at Day 7 after transection to detect SCs (eGFP, green, PLP- eGFP mice), axons (NF, white), and nuclei (Hoechst, blue). Dashed lines indicate the region of the nerve bridge. Scale bars, 300 mm. (C and D) Quantification of SC area (C) and axonal area (D) (n = 7 control mice, n = 8 CCL3 KO mice). (E and F) (E) Representative images of SC cords (eGFP, green) from the bridge showing organized, aligned cords of SCs in control mice, which are more disorganized in CCL3 KO animals. Scale bar, 100 mm, quantified in (F) (n = 169 SC cords from 7 control mice; n = 251 SC cords from 8 CCL3 KO mice). (G) Representative confocal images of longitudinal sections of control and CCL3 KO injured sciatic nerves at Day 5 following injury, immunostained for blood vessels (CD31, magenta). Scale bar, 300 mm. (H) Quantification of blood vessel (BV) area in the nerve bridge (n = 7 control mice, n = 7 CCL3 KO mice). Data are presented as mean ± SEM. For (C), (D), and (H), an unpaired two-tailed Student’s t test was used. For (F), an unpaired two-tailed Welch’s t test was used. *p < 0.05; **p < 0.01; ns, not significant. See also Figure S4.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines THP-1 cell line Prof. Mark Marsh laboratory N/A J774A.1 mouse macrophage cell line Sigma-Aldrich Cat: 91051511 Experimental models: Organisms/strains B6; CBA-Tg(Plp1-EGFP)10Wmac/J mice (Mallon et al.35) Cattin et al.14 Cattin et al.14 Strain# 033357; RRID:IMSR_JAX:033357 B6.129P2-Ccl3tm1Unc/J (CCL3 KO) mice The Jackson Laboratory Strain #:002687; RRID:IMSR_JAX:002687 PLP-eGFP-CCL3 KO mice This paper N/A Sprague-Dawley rats Charles River Laboratories 001 Cat#734476; RRID:RGD734476 Oligonucleotides Rat CCL3: Fwd: 50- CCATATGGAGCTGACACCCC-30 Rev: 50- TCTGCCGGTTTCTCTTGGTC-30 This Paper N/A Mouse CCL3: Fwd: 50- CCATATGGAGCTGACACCCC-30 Rev: 50- AAATGACACCTGGCTGGGAG-30 This Paper N/A Human CCL3: Fwd: 50- ACATTCCGTCACCTGCTCAG -30 Rev: 50- TTGTTGCCAAACAGCCACAC-30 This Paper N/A Rat CCR1: Fwd: 50- CAAAGGCCCAGAAACAAAGCC-30 Rev: 50- AGCCCCGAAGGCTCTTACAT-30 This Paper N/A Human CCR1: Fwd: 50- GGTCCTGGTCCTTGTGCAAT-30 Rev: 50- AGGGAAGCGTGAACAGGAAG-30 This Paper N/A CCL3 siRNA 1: 50-CTAGGTAGACATGATGACAAA-30 This Paper N/A CCL3 siRNA 3: 50-TCGAGGGACTCTTCACTTGAA-30 This Paper N/A CCR1 siRNA: 50-CAGACCCTAGGTGTCAACCAA-30 This Paper N/A Scr: 50-AATTCTCCGAACGTGTCACGT-30 This Paper N/A HCRTM CCL3-B3 probes set Molecular instruments HCRTM HCRTM CCR2-B2 probes set Molecular instruments HCRTM Software and algorithms Fiji/ImageJ Schindelin et al.54 https://imagej.net/Fiji/Downloads Prism GraphPad https://www.graphpad.com/ scientificsoftware/prism Adobe Photoshop CC Adobe Systems https://www.adobe.com Adobe Illustrator CC Adobe Systems https://www.adobe.com Volocity Improvision https://www.volocity4d.com/ Other SPE3 Leica TCS SPE 405nm, 488nm, 561nm and 635nm SPE8 Leica TCS SPE8 STED 3x 405nm, 488nm, 561nm and 635nm LSM900 Zeiss LSM900 405, 488, 561 and 640 lasers Transmission electron microscope (TEM) FEI Tecnai 12 Spirit BioTwin OSIS morada Axiovert 200M Zeiss Axiovert 200M Phase contrast (Transmitted light microscopy) Axio Imager.A1 Zeiss Axio Imager.A1 405nm Subio X Omics Subio Platform https://www.subioplatform.com/ Other RNA-Seq raw and analyzed data Clements et al.28 GEO: GSE103039 Cell Reports 44, 115322, February 25, 2025 17

Techniques: Migration, Control, Two Tailed Test

Journal: Cell reports

Article Title: Netrin-1 feedforward mechanism promotes pancreatic cancer liver metastasis via hepatic stellate cell activation, retinoid, and ELF3 signaling.

doi: 10.1016/j.celrep.2023.113369

Figure Lengend Snippet: Figure 4. Elf3 increases expression of Netrin-1 in human and mouse pancreatic cancer cells (A) ATAC-seq analysis of the Elf3 promoter for metastatic Met38 and primary Ink4a.1 pancreatic cancer cells, n = 2/group. (B) Expression of Elf3 was determined by qPCR in multiple primary and metastatic mouse (left) and human (right) pancreatic cancer cell lines treated with 10 mM all-trans-retinoic acid (ATRA) for 18 h. Actin expression was used for normalization. In all cases except for MIAPACA-2, the increase in Elf3 mRNA was statistically significant by two-tailed t test, n = 3/group. (C) ChIP experiment to demonstrate that RARa interacts with the Elf3 promoter, n = 4/group. (D) Following 7 days of treatment with DMSO or varying concentrations of ATRA, the percentages of E-cadherin-positive (left) and vimentin-positive (right) cells were determined by flow cytometry in three cell lines, each of which had been developed from pancreatic tumors generated by different KPC-Arid1a/ mice, n = 3/group. (E) The top panel shows conservation of consensus Elf3 transcription factor binding sequence within the Netrin-1 promoter in a variety of species, while the bottom panel shows results of a ChIP experiment indicating that Elf3 interacts with this region on the mouse Ntn1 gene. (F) Ink4a.1 cells were transfected for 72 h with pCMV6 or with pCMV6-Elf3, followed by qPCR to assay Netrin-1 transcription. Actin was used as a normalization control, n = 3/group. (G) Met38 sgControl and sgElf3 were treated with DMSO or 10 mM ATRA for 18 h and analyzed for Netrin-1 RNA expression. The top graph shows the fold change of Netrin-1 expression for ATRA vs. DMSO, n = 3. All experiments were completed at least in duplicate and represent mean ± SEM. In the bottom panel the reduction of Elf3 protein is demonstrated by western blot analysis; positions of molecular weight markers, in kDa, are indicated. Statistical analysis was completed using two-tailed Student’s t test (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001).

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER ESE1 (ELF3) (NM_004433) Human Tagged ORF Clone Origene RC200631 Software and algorithms ImageScope software Leica Biosystems Imaging N/A VisioPharm 19 software VisioPharm N/A GraphPad Prism GraphPad N/A QuPath digital pathology analysis software https://qupath.github.io/ N/A Integrated Genome Browser https://bioviz.org/ N/A FastQC https://www.bioinformatics. babraham.ac.uk/projects/fastqc/ N/A Salmon https://combine-lab.github. io/salmon/getting_started/ N/A EdgeR https://bioconductor.org/ packages/release/bioc/html/ edgeR.html N/A R package GAGE https://bioconductor.org/ packages/release/bioc/html/ gage.html N/A Morpheus https://software.broadinstitute. org/morpheus/ N/A ShinyGO 0.77 http://bioinformatics.sdstate. edu/go/ N/A Other Covidien 30-gauge needles Fisher Scientific 22-557-172 CELOX Rapid Hemostatic Gauze Fisher Scientific NC1419211 Ethicon PDS II (Polydioxanone) Suture, Size 5-0, RB-1, 2700 Fisher Scientific NC1985442 BD Autoclip Wound Closing System Fisher Scientific 22–275998 Falcon Cell Culture Inserts, 8 mm Fisher Scientific 08-771-21

Techniques: Expressing, Two Tailed Test, Cytometry, Generated, Binding Assay, Sequencing, Transfection, Control, RNA Expression, Western Blot, Molecular Weight

Journal: Cell reports

Article Title: Netrin-1 feedforward mechanism promotes pancreatic cancer liver metastasis via hepatic stellate cell activation, retinoid, and ELF3 signaling.

doi: 10.1016/j.celrep.2023.113369

Figure Lengend Snippet: Figure 7. The Netrin-1 feedforward mecha- nism that promotes liver metastasis EVs containing Netrin-1 activate HSCs through both long-range (A) and possibly short-range communi- cation upon dissemination in the liver (B). Upon activation by Netrin-1, HSCs dump their retinoic acid stores (C). The free retinoic acid is taken up by DTCs by their retinoic acid receptors (D), leading to upre- gulation of Netrin-1 directly and indirectly through Elf3 upregulation. Through autocrine signaling (E) by Unc5b receptors, newly arrived DTCs increase sur- vival potential through Netrin-1 excretion. In addi- tion, activated hepatic stellate cells deposit collagen into the microenvironment (F), which over time al- lows macrometastases to become established in the liver (G).

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER ESE1 (ELF3) (NM_004433) Human Tagged ORF Clone Origene RC200631 Software and algorithms ImageScope software Leica Biosystems Imaging N/A VisioPharm 19 software VisioPharm N/A GraphPad Prism GraphPad N/A QuPath digital pathology analysis software https://qupath.github.io/ N/A Integrated Genome Browser https://bioviz.org/ N/A FastQC https://www.bioinformatics. babraham.ac.uk/projects/fastqc/ N/A Salmon https://combine-lab.github. io/salmon/getting_started/ N/A EdgeR https://bioconductor.org/ packages/release/bioc/html/ edgeR.html N/A R package GAGE https://bioconductor.org/ packages/release/bioc/html/ gage.html N/A Morpheus https://software.broadinstitute. org/morpheus/ N/A ShinyGO 0.77 http://bioinformatics.sdstate. edu/go/ N/A Other Covidien 30-gauge needles Fisher Scientific 22-557-172 CELOX Rapid Hemostatic Gauze Fisher Scientific NC1419211 Ethicon PDS II (Polydioxanone) Suture, Size 5-0, RB-1, 2700 Fisher Scientific NC1985442 BD Autoclip Wound Closing System Fisher Scientific 22–275998 Falcon Cell Culture Inserts, 8 mm Fisher Scientific 08-771-21

Techniques: Activation Assay

Journal: Cell reports

Article Title: Deletion of STAT3 from Foxd1 cell population protects mice from kidney fibrosis by inhibiting pericytes trans-differentiation and migration.

doi: 10.1016/j.celrep.2022.110473

Figure Lengend Snippet: Figure 1. STAT3 is expressed in tubular epithelial cells in AKI and also in interstitial cells in CKD of human and mouse kidneys (A) pSTAT3 immunostaining (red) in healthy (n = 10), AKI (acute tubular necrosis [ATN]; n = 5), and CKD (diabetic nephropathy [DN]; n = 10) paraffin sections of human kidneys. Na+ K+ ATPase (green) for tubular staining. DAPI staining (blue) for nuclei. Images were captured on a confocal microscope using 603 objective. Scale bars represent 10 mm. Percentage of pSTAT3-positive tubular epithelial cells normalized to total nuclei (n = 5–10) is shown. Percentage of pSTAT3-positive interstitial cells normalized to total nuclei (n = 5–10) is shown. p values are shown above the bars as determined by two-tailed unpaired t test. (B) STAT3 immunostaining (green) in healthy and CKD paraffin sections of human kidneys (n = 10). Images were captured on a confocal microscope using 603 objective. Scale bars represent 10 mm. White arrows show tubular and gray arrows show interstitial staining. Scale bars represent 10 mm. Fold STAT3 intensity as compared with healthy kidneys plotted after normalization to number of total nuclei (n = 10) is shown. p values are shown above the bars as determined by two-tailed unpaired t test. (C) Co-immunostaining for a-SMA (green) and pSTAT3 (red) staining on paraffin sections of human healthy and CKD kidneys (n = 10). Arrows show double- positive cells. Scale bars represent 10 mm. Images were captured on a confocal microscope using 603 objective. Fold of a-SMA and pSTAT3 double-positive cells were plotted as compared with healthy kidneys (n = 10). p values are shown above the bars as determined by two-tailed unpaired t test. (D) a-SMA (green) and pSTAT3 (red) in normal (day 0) and folic-acid-induced AKI (day 2) and fibrotic (day 14) paraffin kidney sections. Double-positive cells are shown by arrows (n = 5). Scale bars represent 10 mm. Quantitation of percentage of tubular pSTAT3-positive cells normalized to total nuclei (n = 5) is shown. Quantitation of percentage of interstitial pSTAT3-positive cells normalized to total nuclei (n = 5) is shown. Quantitation of percentage of a-SMA and pSTAT3- positive cells (n = 5). p values are shown above the bars as determined by two-tailed unpaired t test.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, peptides, and recombinant proteins Stattic Millipore Sigma Cat#R415 IL-6 R&D Systems Cat#7270-IL-025/CF DAPI Vector laboratories Cat#H-1200-10 F-Actin Invitrogen Cat#A-12381 Cell mask Thermo Fisher Scientific Cat#C2925 Eagle’s Basal medium Thermo Fisher Scientific Cat#21010-046 BrdU Thermo Fisher Scientific Cat#B5002-5G Heparin Fisher Scientific Cat#H19 LTL Vector Laboratories Cat#NC0127927 Dual luciferase assay kit Promega Corporation Cat#E1910 Glutamine ATCC Cat#30-2214 Critical commercial assays Lightning-Link Rapid Alexa Fluor 488 Antibody Labeling Kit Novus Biologicals Cat#ab236553 Dual-Luciferase Reporter assay Promega Cat#E1910 BrdU assay kit Abcam Cat#ab126556 RNeasy Mini Kit Qiagen Cat#74104 miRNeasy Mini Kit Qiagen Cat#217084 High-Capacity cDNA Reverse Transcription Kit Applied Biosystems Cat#4368814 TaqManTM Universal PCR Master Mix ThermoFisher Scientific Cat#4304437 Kappa Genotyping Kit Roche Cat#KK7352 Quantitative Colorimetric Urea Determination Kit Bio Assay Systems Cat#DIUR-100 PureLink Genomic DNA Mini Kit Thermo Fisher Scientific Cat#K182002 Deposited data GSM3176738 NCBI https://www.ncbi.nlm.nih.gov/geo/query/ acc.cgi?acc=GSM3176738 GSM3176739 NCBI https://www.ncbi.nlm.nih.gov/geo/query/ acc.cgi?acc=GSM3176739 Experimental models: Cell lines HEK 293 ATCC, USA Cat#CRL-1573, RRID:CVCL_0045 10T1/2 ATCC, USA Cat#CCL-226, RRID:CVCL_0190 Experimental models: Organisms/strains Stat3flox The Jackson Laboratory Cat#016923 Foxd1GC (Kobayashi et al., 2014) N/A Oligonucleotides Primers for quantitative PCR: listed in Table S1 This paper N/A Primers and sgRNAs for the construction of CRISPR plasmids: listed in Table S1 This paper N/A Recombinant DNA GAPDH Luciferase Dr. Matthias Brock N/A STAT3 Luciferase Dr. David Frank N/A lenti-CRISPRV2 Addgene Cat#52961 pCMV-VSV-G Addgene Cat#8454 pRSV-REV Addgene Cat#12253 pMDLg/pRRE Addgene Cat#12251 Software and algorithms GraphPad Prism 9 GraphPad Software RRID:SCR_002798 FIJI v1.0 (Schindelin et al., 2012) RRID:SCR_003070 (Continued on next page) Cell Reports 38, 110473, March 8, 2022 e2

Techniques: Immunostaining, Staining, Microscopy, Two Tailed Test, Quantitation Assay

Journal: Cell reports

Article Title: Deletion of STAT3 from Foxd1 cell population protects mice from kidney fibrosis by inhibiting pericytes trans-differentiation and migration.

doi: 10.1016/j.celrep.2022.110473

Figure Lengend Snippet: Figure 3. Foxd1 Cre-mediated depletion of Stat3 shows decreased macrophage infiltration, inflammation, decreased DNA damage signaling, and reduced cell proliferation in fibrotic kidneys (A) Co-immunostaining for F4/80 (green) and Na+ K+ ATPase (red) on the paraffin sections of mouse kidneys at 14 days post-AA treatment. Scale bars represent 10 mm. Fold change in the intensity of F4/80 normalized to nuclei and plotted in comparison with control kidneys at day 14 post-AA treatment (n = 4) is shown. p values are shown above the bars as determined by two-tailed unpaired t test. (B) FACS strategy for macrophages from control and Stat3 KO mouse kidneys at 14 days post-AA treatment. (C and D) TaqMan base quantitative RT-PCR for (C) inflammatory mediators and M1 markers and (D) M2 markers from macrophages isolated from mouse kidneys at 14 days post-AA treatment. Fold changes were plotted in comparison with control mice at 14 days post-AA treatment (n = 3). p values are shown above the bars as determined by two-tailed unpaired t test. (E) Co-immunostaining of F4/80 (green) and IL-10 (red) and IL-10 (red) alone on the paraffin sections of mouse kidneys 14 days post-AA treatment. Scale bars represent 10 mm. Fold change in the intensity of IL-10 normalized to nuclei and plotted in comparison with control kidneys at day 14 post-AA treatment (n = 4) is shown. p values are shown above the bars as determined by two-tailed unpaired t test. (F) Representative immunostaining for pH2AX (green) in the control and Stat3 KO mouse paraffin kidney sections at 14 days post-AA injection. Scale bars represent 10 mm. Images were captured on a wide-field immunofluorescence microscope using 603 objective. Quantitation of interstitial and tubular pH2AX positive cells (n = 4) is shown. Fold changes were calculated by normalizing the number of pH2AX cells to number of nuclei and plotted in comparison with control mice at 14 days post-AA treatment. p values are shown above the bars as determined by two-tailed unpaired t test. (G) Co-immunostaining for PDGFRb (green) and pH2AX (red) on the paraffin sections of control mouse kidneys at 14-days post AA treatment. Scale bar rep- resents 10 mm. PDGFRb and pH2AX double-positive cells are shown by white arrows. Numbers of PDGFRb and pH2AX double-positive cells were counted and plotted (n = 4). (H) Immunostaining for Ki67 (cyan) in the mouse kidneys 14 days post-AA injection. Images were captured on a wide-field immunofluorescence microscope using 603 objective. Quantitation of interstitial and tubular Ki67-positive cells (n = 4) is shown. Scale bars represent 10 mm. Fold changes were calculated by normalizing the number of pH2AX cells to number of nuclei and plotting in comparison with control mice at 14 days post-AA treatment. p values are shown above the bars as determined by two-tailed unpaired t test. (I) Co-immunostaining for PDGFRb (green) and Ki67 (red) on the paraffin sections of control mouse kidneys at 14 days post-AA treatment. Scale bar represents 10 mm. PDGFRb and Ki67 double-positive cells are shown by white arrows. Numbers of PDGFRb and Ki67 double-positive cells were counted and plotted (n = 4).

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, peptides, and recombinant proteins Stattic Millipore Sigma Cat#R415 IL-6 R&D Systems Cat#7270-IL-025/CF DAPI Vector laboratories Cat#H-1200-10 F-Actin Invitrogen Cat#A-12381 Cell mask Thermo Fisher Scientific Cat#C2925 Eagle’s Basal medium Thermo Fisher Scientific Cat#21010-046 BrdU Thermo Fisher Scientific Cat#B5002-5G Heparin Fisher Scientific Cat#H19 LTL Vector Laboratories Cat#NC0127927 Dual luciferase assay kit Promega Corporation Cat#E1910 Glutamine ATCC Cat#30-2214 Critical commercial assays Lightning-Link Rapid Alexa Fluor 488 Antibody Labeling Kit Novus Biologicals Cat#ab236553 Dual-Luciferase Reporter assay Promega Cat#E1910 BrdU assay kit Abcam Cat#ab126556 RNeasy Mini Kit Qiagen Cat#74104 miRNeasy Mini Kit Qiagen Cat#217084 High-Capacity cDNA Reverse Transcription Kit Applied Biosystems Cat#4368814 TaqManTM Universal PCR Master Mix ThermoFisher Scientific Cat#4304437 Kappa Genotyping Kit Roche Cat#KK7352 Quantitative Colorimetric Urea Determination Kit Bio Assay Systems Cat#DIUR-100 PureLink Genomic DNA Mini Kit Thermo Fisher Scientific Cat#K182002 Deposited data GSM3176738 NCBI https://www.ncbi.nlm.nih.gov/geo/query/ acc.cgi?acc=GSM3176738 GSM3176739 NCBI https://www.ncbi.nlm.nih.gov/geo/query/ acc.cgi?acc=GSM3176739 Experimental models: Cell lines HEK 293 ATCC, USA Cat#CRL-1573, RRID:CVCL_0045 10T1/2 ATCC, USA Cat#CCL-226, RRID:CVCL_0190 Experimental models: Organisms/strains Stat3flox The Jackson Laboratory Cat#016923 Foxd1GC (Kobayashi et al., 2014) N/A Oligonucleotides Primers for quantitative PCR: listed in Table S1 This paper N/A Primers and sgRNAs for the construction of CRISPR plasmids: listed in Table S1 This paper N/A Recombinant DNA GAPDH Luciferase Dr. Matthias Brock N/A STAT3 Luciferase Dr. David Frank N/A lenti-CRISPRV2 Addgene Cat#52961 pCMV-VSV-G Addgene Cat#8454 pRSV-REV Addgene Cat#12253 pMDLg/pRRE Addgene Cat#12251 Software and algorithms GraphPad Prism 9 GraphPad Software RRID:SCR_002798 FIJI v1.0 (Schindelin et al., 2012) RRID:SCR_003070 (Continued on next page) Cell Reports 38, 110473, March 8, 2022 e2

Techniques: Immunostaining, Comparison, Control, Two Tailed Test, Quantitative RT-PCR, Isolation, Injection, Microscopy, Quantitation Assay

Journal: Cell reports

Article Title: Deletion of STAT3 from Foxd1 cell population protects mice from kidney fibrosis by inhibiting pericytes trans-differentiation and migration.

doi: 10.1016/j.celrep.2022.110473

Figure Lengend Snippet: Figure 4. IL-6-mediated STAT3 phosphorylation regulates proliferation, migration, and profibrotic signaling in pericyte-like 10T1/2 cells (A) Representative western blots for pSTAT3 and STAT3 following treatment with IL-6 or IL-6 in combination with stattic in 10T1/2 cells. Fold changes were calculated after normalization to b-actin and plotted in comparison with control (ctrl) cells (n = 3). p values are shown above the bars as determined by two-tailed unpaired t test. (B) Nuclear translocation of STAT3 in 10T1/2 cells following IL-6 and or stattic treatment. Scale bars represent 10 mm. Intensity of pSTAT3 was normalized to total number of cells, and fold change in comparison with control cells was plotted (n = 3). p values are shown above the bars as determined by two-tailed unpaired t test. (C and D) Proliferation of 10T1/2 cells following IL-6 and stattic treatments using BrdU incorporation assay in a (C) time- and (D) STAT3-dependent manner (n = 3). p values are shown above the bars as determined by two-tailed unpaired t test. (E) Immunofluorescence staining for Ki67 with or without IL-6 and stattic treatments in 10T1/2 cells. Scale bars represent 10 mm. Intensity of Ki67 was normalized to total number of cells, and fold change in comparison with control cells was plotted (n = 3). p values are shown above the bars as determined by two-tailed unpaired t test. (F) Migration of 10T1/2 cells following IL-6 and stattic treatment using scratch assay. Scale bars represent 50 mm. Percent cell migration was calculated as compared with gap area in the control cells at 24 h (n = 3). p values are shown above the bars as determined by two-tailed unpaired t test. (G) Transwell migration of 10T1/2 cells treated with IL-6 or IL-6 in combination with stattic. Scale bars represent 50 mm. Cell area normalized to cell number calculated for CellMask stain (green) and fold change were calculated as compared with control cells (n = 3). p values are shown above the bars as determined by two-tailed unpaired t test. (H–K) Immunostaining for (H) pSMAD2 (green), (I) collagen 1 (green), (J) fibronectin (green), and (K) a-SMA (green) following IL-6 alone or in combination with stattic on 10T1/2 cells. Scale bars represent 10 mm. Intensity of pSMAD2, collagen 1, fibronectin, and a-SMA was normalized with number of cells, and fold change was plotted in comparison with control cells (n = 3). p values are shown above the bars as determined by two-tailed unpaired t test.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, peptides, and recombinant proteins Stattic Millipore Sigma Cat#R415 IL-6 R&D Systems Cat#7270-IL-025/CF DAPI Vector laboratories Cat#H-1200-10 F-Actin Invitrogen Cat#A-12381 Cell mask Thermo Fisher Scientific Cat#C2925 Eagle’s Basal medium Thermo Fisher Scientific Cat#21010-046 BrdU Thermo Fisher Scientific Cat#B5002-5G Heparin Fisher Scientific Cat#H19 LTL Vector Laboratories Cat#NC0127927 Dual luciferase assay kit Promega Corporation Cat#E1910 Glutamine ATCC Cat#30-2214 Critical commercial assays Lightning-Link Rapid Alexa Fluor 488 Antibody Labeling Kit Novus Biologicals Cat#ab236553 Dual-Luciferase Reporter assay Promega Cat#E1910 BrdU assay kit Abcam Cat#ab126556 RNeasy Mini Kit Qiagen Cat#74104 miRNeasy Mini Kit Qiagen Cat#217084 High-Capacity cDNA Reverse Transcription Kit Applied Biosystems Cat#4368814 TaqManTM Universal PCR Master Mix ThermoFisher Scientific Cat#4304437 Kappa Genotyping Kit Roche Cat#KK7352 Quantitative Colorimetric Urea Determination Kit Bio Assay Systems Cat#DIUR-100 PureLink Genomic DNA Mini Kit Thermo Fisher Scientific Cat#K182002 Deposited data GSM3176738 NCBI https://www.ncbi.nlm.nih.gov/geo/query/ acc.cgi?acc=GSM3176738 GSM3176739 NCBI https://www.ncbi.nlm.nih.gov/geo/query/ acc.cgi?acc=GSM3176739 Experimental models: Cell lines HEK 293 ATCC, USA Cat#CRL-1573, RRID:CVCL_0045 10T1/2 ATCC, USA Cat#CCL-226, RRID:CVCL_0190 Experimental models: Organisms/strains Stat3flox The Jackson Laboratory Cat#016923 Foxd1GC (Kobayashi et al., 2014) N/A Oligonucleotides Primers for quantitative PCR: listed in Table S1 This paper N/A Primers and sgRNAs for the construction of CRISPR plasmids: listed in Table S1 This paper N/A Recombinant DNA GAPDH Luciferase Dr. Matthias Brock N/A STAT3 Luciferase Dr. David Frank N/A lenti-CRISPRV2 Addgene Cat#52961 pCMV-VSV-G Addgene Cat#8454 pRSV-REV Addgene Cat#12253 pMDLg/pRRE Addgene Cat#12251 Software and algorithms GraphPad Prism 9 GraphPad Software RRID:SCR_002798 FIJI v1.0 (Schindelin et al., 2012) RRID:SCR_003070 (Continued on next page) Cell Reports 38, 110473, March 8, 2022 e2

Techniques: Phospho-proteomics, Migration, Western Blot, Comparison, Control, Two Tailed Test, Translocation Assay, BrdU Incorporation Assay, Staining, Wound Healing Assay, Immunostaining

Journal: Cell reports

Article Title: Deletion of STAT3 from Foxd1 cell population protects mice from kidney fibrosis by inhibiting pericytes trans-differentiation and migration.

doi: 10.1016/j.celrep.2022.110473

Figure Lengend Snippet: Figure 5. STAT3 directly regulates attachment, spreading, migration, proliferation, and profibrotic signaling in 10T1/2 cells (A) Scheme for STAT3 activation using synergistic activation mediators (SAMs) and activation mutants (STAT3-C). (B–F) Immunostaining for (B) pSTAT3 (green), (C) pSMAD2 (green), (D) collagen 1, (E) fibronectin, and (F) a-SMA (green) on STAT3-activated 10T1/2 cells. Scale bars represent 10 mm. Intensity of staining for pSTAT3, pSMAD2, collagen 1, fibronectin, and a-SMA were normalized with cell numbers and plotted in com- parison with control (ctrl) cells (n = 3). p values are shown above the bars as determined by two-tailed unpaired t test. (G) Transwell migration of 10T1/2 cells in STAT3-activated cells. Scale bars represent 50 mm. Cell area normalized to cell number was calculated by CellMask, and fold change was plotted in comparison with control cells (n = 3). Total number of migrated cells was counted on the lower side of the polycarbonate membrane by counting the nuclei (n = 3). p values are shown above the bars as determined by two-tailed unpaired t test. (H) Proliferation of Stat3 WT and KO 10T1/2 cells as assayed by BrdU incorporation assay for 5 days. Percent change was calculated in comparison with day-1 Stat3 WT cells (n = 3). p values are shown above the bars as determined by two-tailed unpaired t test. (I) Adherence assay as shown by staining for F-actin (red) of Stat3 WT and Stat3 KO 10T1/2 cells at 1 h after plating. Scale bars represent 10 mm. Intensity of F-actin normalized to total cell number was calculated, and fold change were calculated in comparison with Stat3 WT cells (n = 3). p values are shown above the bars as determined by two-tailed unpaired t test. (J) Spreading assay as shown staining for F-actin (red) of Stat3 WT and Stat3 KO 10T1/2 cells at 3 h after plating. Scale bars represent 10 mm. Cell area of F-actin normalized to total cell number and fold change were calculated in comparison with Stat3 WT cells (n = 3). p values are shown above the bars as determined by two-tailed unpaired t test.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, peptides, and recombinant proteins Stattic Millipore Sigma Cat#R415 IL-6 R&D Systems Cat#7270-IL-025/CF DAPI Vector laboratories Cat#H-1200-10 F-Actin Invitrogen Cat#A-12381 Cell mask Thermo Fisher Scientific Cat#C2925 Eagle’s Basal medium Thermo Fisher Scientific Cat#21010-046 BrdU Thermo Fisher Scientific Cat#B5002-5G Heparin Fisher Scientific Cat#H19 LTL Vector Laboratories Cat#NC0127927 Dual luciferase assay kit Promega Corporation Cat#E1910 Glutamine ATCC Cat#30-2214 Critical commercial assays Lightning-Link Rapid Alexa Fluor 488 Antibody Labeling Kit Novus Biologicals Cat#ab236553 Dual-Luciferase Reporter assay Promega Cat#E1910 BrdU assay kit Abcam Cat#ab126556 RNeasy Mini Kit Qiagen Cat#74104 miRNeasy Mini Kit Qiagen Cat#217084 High-Capacity cDNA Reverse Transcription Kit Applied Biosystems Cat#4368814 TaqManTM Universal PCR Master Mix ThermoFisher Scientific Cat#4304437 Kappa Genotyping Kit Roche Cat#KK7352 Quantitative Colorimetric Urea Determination Kit Bio Assay Systems Cat#DIUR-100 PureLink Genomic DNA Mini Kit Thermo Fisher Scientific Cat#K182002 Deposited data GSM3176738 NCBI https://www.ncbi.nlm.nih.gov/geo/query/ acc.cgi?acc=GSM3176738 GSM3176739 NCBI https://www.ncbi.nlm.nih.gov/geo/query/ acc.cgi?acc=GSM3176739 Experimental models: Cell lines HEK 293 ATCC, USA Cat#CRL-1573, RRID:CVCL_0045 10T1/2 ATCC, USA Cat#CCL-226, RRID:CVCL_0190 Experimental models: Organisms/strains Stat3flox The Jackson Laboratory Cat#016923 Foxd1GC (Kobayashi et al., 2014) N/A Oligonucleotides Primers for quantitative PCR: listed in Table S1 This paper N/A Primers and sgRNAs for the construction of CRISPR plasmids: listed in Table S1 This paper N/A Recombinant DNA GAPDH Luciferase Dr. Matthias Brock N/A STAT3 Luciferase Dr. David Frank N/A lenti-CRISPRV2 Addgene Cat#52961 pCMV-VSV-G Addgene Cat#8454 pRSV-REV Addgene Cat#12253 pMDLg/pRRE Addgene Cat#12251 Software and algorithms GraphPad Prism 9 GraphPad Software RRID:SCR_002798 FIJI v1.0 (Schindelin et al., 2012) RRID:SCR_003070 (Continued on next page) Cell Reports 38, 110473, March 8, 2022 e2

Techniques: Migration, Activation Assay, Immunostaining, Staining, Control, Two Tailed Test, Comparison, Membrane, BrdU Incorporation Assay